Support

CES Order Guide

Sample Preparation

The quality of DNA is the single most important factor in obtaining high quality sequence data.

To ensure proper concentration, please check your samples by electrophoresis prior to shipping. There should be a single clear band of the appropriate size when loading 1 µl of the sample on a 1% agarose gel with EtBr. Smearing or multi-bands can be causal factors in sequencing failures. Using UV absorbance to quantify DNA may provide inaccurate measurements of target DNA concentration.

DNA should be dissolved in Nuclease-Free distilled water. Nuclease-Free super low EDTA TE buffer (10mM Tris-HCI, pH8.0, 0.01mM EDTA) can be used but with caution. If the TE buffer with EDTA (concentration of 0.1-1Mm) is used for dissolving DNA, EDTA take up free magnesium ions, which reduces DNA polymerase activity resulting in sequencing reaction failure.

Sequencing Sample/Primer Requirements

Sample Type/Format DNA size Concentration Volume
Plasmid 4 ~ 8kb 80 ~ 150 ng/µl 10 µl per reaction
8 ~ 15kb 150 ~ 200 ng/µl
PCR Product Less than 300bp 10 ~ 20 ng/µl
300bp ~ 700bp 20 ~ 30 ng/µl
Over 700bp 30 ~ 50 ng/µl
BAC 40 ~ 200kb 0.5 ~ 1ng/µl 15 µl per reaction
gDNA - 30 ~ 50 ng/µl 15 µl per sample
Premix Plasmid - 100 ng/µl 5 µl sample + 5 µl primer
Purified PCR Product - 50 ng/µl
Primer - 5 pmol/µl
Primer Primer size Concentration Volume
Primer for regular sequencing 18 ~ 27 mer
(Tm 55℃ - 60℃)
2 ~ 5 pmol/µl 10 µl per reaction
Primer for BAC sequencing 100 pmol/µl

Samples and primers can be submitted in 1.5 ml tubes, strip tubes or 96-well PCR plates.

A temperature control is not necessary in the below cases. Samples are stable for a few days at room temperature.

  • DNA samples in water or TE
  • Bacterial cells in agar-stab or agar plate culture

Sample Submission

Samples and primers can be submitted in 1.5 ml tubes, strip tubes or 96 well PCR plates.

As for the DNA samples in water or TE, bacterial cells in agar-stab, or agar plate culture, temperature control is not necessary. Samples are stable for a few days at room temperature.

Single tube order:

  • Agar-stab/Agar-plate culture can be shipped at room temperature.
  • Glycerol stock should be enclosed with dry ice.
  • We recommend to send samples/primers in 1.5ml Microcentrifuge tubes.
  • Complimentary re-sequencing service is included if failed reactions are verified with reasonable reasons.

Plate order:

  • We recommend 8 strip caps to seal the plates.
  • U-bottom and Flat-bottom plate are not accepted.
  • If you would like to use multiple primers with your plate order, the most cost-effective method is to provide “Mirror” plate of samples and primers.
  • Re-sequencing is additionally charged.
  • Please prepare samples to avoid any well-to-well concentration difference or size difference for
    quality results.

Primer:

  • Universal primers are provided for free of charge (ex. M13F, T7, T3)
  • We have primer design and synthesis service.

Sealing of 96 Well Plates

  • Strip caps are recommended to seal 96-well plates.
  • Carefully seal the 96 well plates with strip caps (8-strips or 12-strips) or polypropylene films (relatively thick and malleable).
  • Aluminum sealing or polyester films are not recommended.

Place samples into strip-capped well plate as shown below. To avoid potential damage, please use out-skirted well plate.

Seal tightly to avoid sample evaporation or contamination during transit. Unsatisfactory results due to improper sample preparation or shipping by customer will be charged for re-sequencing.

Ordering

There are two methods of placing an order:

  1. Online Ordering System:
    We highly recommend using our online ordering system (LIMS) where you can easily place an order and make a payment. Please visit our website www.macrogenusa.com and open an account to start placing an order.
  2. Email:
    Send your order to us at customerservice@nullmacrogenusa.com. If you are a first time user, please consult with your purchasing agent in regards to the payment method. You may need to obtain a Purchase Order (PO) number from procurement office in order to make a payment for your order.

Online Ordering Procedure

Log in > Go to “Place an Order” > Complete basic information > Enter general information (email, billing, sample type, etc.) > Complete order by uploading template file or directly typing in reaction information > Print confirmation page > Include with the sample package > Ship or drop off samples

Shipping Samples

Shipping by mail

Ship your samples to:
Attn: CES Sample Receiving
1330 Piccard Drive STE 103
Rockville MD 20850 USA 

  • Shipping coverage is $30 for every 20 reactions or each 96-well plate  (Maximum shipping coverage is $90).
  • Select delivery type as “Standard Overnight”. Dry ice or ice packs are not necessary in the shipment unless you are sending cultured/uncultured cell.

Sample drop boxes & Pick up service

We currently have drop off locations at various institutions. You can check the available drop box location when you place an order. Please contact us for the availability of sample drop box near you.

sequencing@nullmacrogenusa.com, (301) 251-1007 ext. 302

Sample pick up at the Bethesda NIH campus

We provide daily pickup service for NIH customers at Bethesda campus. If you are at our drop box locations (BLD 33, 35, 49, 50), please drop off your samples before 2PM to ensure your sample pickup. For building number (BLG 4,5,6,8,9,10), please place an online order before 2 PM if you would like to request pickup online or call the office at (301) 251-1007 to schedule a pickup. Our courier visits the campus from 2PM to 4 PM every weekday.

Drop off samples at our facility before 5:00 pm to get your results back next morning.

Drop box can be found at the South entrance of the building. Please call us for direction at (301) 251-1007.

Psomagen, Inc.
1330 Piccard Drive
Rockville, MD 20850

Turnaround Time

  • Sequencing results are available within 12 to 24 hours upon the sample arrival at Psomagen facility.
  • If you request primer synthesis service with your sequencing order, the result will take 2-3 business days.
  • Plasmid preparation and any additional services may take 1-2 business days before proceeding with sequencing reaction.

Download Results

  1. Access your results page by clicking “Results” Tab
  2. Click on the corresponding “Report” tab to see your sequence data
  3. Move cursor over the links in the “Label” column to access individual sets of data
  4. You are able to view your chromatogram online, and downloads are available in six formats.
  5. To save data to your PC, click download. You will see a popup window to verify you are a permitted user.
  6. In cases of quality below our standard, blank boxes will be available for selection. Select order for re-trial. Then, select repeat.

Troubleshooting

Most of sequencing failure is caused by sample condition or the specificity of composition, in this case there is no possibility of improvement through any other approach use, and therefore it is not the case of reanalysis Psomagen sequencing policy. The patterns in problems have been summarized to help user’s understanding in sequencing data.

Psomagen policies for retesting

The objective of reanalysis in Psomagen sequencing service is to confirm the possibility of machine error, operator’s mishandling, and only reanalysis is carried out in the case of that improvement is expected. Therefore, sending a sample from a new batch is not considered the subject for reanalysis even though it is the same name. The following failures caused by template preparation or composition should be fully paid for the analysis service.

No Signal

Pattern

  • Peaks are irregular and may appear as if it is just mixed peaks. However, such peaks are actually not normal peaks but just noise signal.
  • The signal strength is less than 500.

Cause

  • The concentration of DNA is too low.
  • The concentration of primer is too low or Tm is inappropriate for the sequencing reaction.
  • The primer binding site is not on the sequence of sample DNA.

Action

  • To get fine sequencing result, the sample concentration is required as below;
    • Plasmid DNA (high copy number) ; 100-150 ng/ul
    • PCR product ; 25-50 ng/ul
      When you check the sample concentration by gel electrophoresis, band should be present on a gel if you load a sample on 1% agarose gel using 1ul of the sample.
  • Provide the primer at 5 pmole/ul or 10pmole/ul.
  • The annealing temperature for sequencing reaction is 50 (fixed) so Tm is recommended around 55-60.
  • Check whether the primer binding site exists on the sequence of sample DNA
  • In case of plasmid, compare the sequence between the sequencing primer and the vector to confirm whether the primer binding site exists.
  • Especially for primer M13R and M13R-pUC(-40), there is difference between vector providers for primer names, so it is required to check the sequence all the time whether the primer’s sequence is on the sequence of the sample.
    • Primer M13R ; GCGGATAACAATTTCACACAGG
    • Primer M13R-pUC(-40) ; CAGGAAACAGCTATGAC
  • The primer binding site might be damaged. We would like to recommend that you try to use alternative primer.

Figure 1. No Signal

Mixed Template

Pattern

  • In case of plasmid, multiple peaks appear from the beginning of insertion position although clear peaks are shown up to vector position.
  • In case of PCR product, the following aspects appear depending on what kind of non-specific PCR product is.
    • If the mixed non-specific PCR product has similar size with the expected PCR product;
      • Mixed sequence is present from the beginning to the end. In case two PCR products have similar sizes, it can be shown as if it is single band on a agarose gel.
    • If the mixed non-specific PCR product is with Insertion or deletion;
      • Sequence becomes mixed at position of Insertion or deletion although clean peaks are present in the beginning. For most cases, such non-specific PCR product is longer or shorter just several bases than the expected PCR product, this also can be shown as if it is single band on a agarose gel.

Cause

  • In the process of plasmid DNA preparation, two colonies are picked simultaneously.
  • Not only PCR product you target but also there is non-specific PCR product.

Action

  • Preparing a new DNA sample is recommended.

Figure 2. Mixed template

Compression

Pattern

  • Multiple peaks appear from a certain point.

Cause

  • Compression occurs due to DNA fragments of different size with the same electrophoretic mobility. This phenomenon is thought to be caused by regions of secondary structure within the template DNA and as different peaks are detected simultaneously it appears as multi-peaks and although it rarely happens, but it can be found in the regions with a high G/C or high A/T content.

Action

  • Confirm whether the result is improved by using the opposite direction primer.

Figure 3. Compression

Multiple Binding

Pattern

  • Multiple peaks appear at a different position with good signal strength.

Cause

  • If accidentally more than 2 regions have homology for the primer binding sequence the primer has multiple bindings although the template is one.
  • When more than 2 different templates are mixed this phenomenon appears. When 2 PCR products with the similar size are mixed, it looks a single band on the agarose gel.

Action

  • Design a long primer or design a new primer being able to avoid multiple binding.
  • The use of an opposite direction primer can be helpful.
  • If more than 2 similar sized products are mixed, redo PCR in a more optimized PCR

Figure 4. Multiple Binding

Slippage

Pattern

  • The phenomenon that mixed peaks appear in the back position of long homo-polymer region.

Cause

  • Pairing occurs incorrectly in homopolymer region during polymerization

Action

  • Try sequencing by both directions. For example, if slippage pattern appears when the reverse primer is used try sequencing toward the forward direction.
  • Perform sequencing by designing a new primer avoiding homopolymer region.

Figure 5. Homopolymer region-poly A

Mixed Base

Pattern

  • Partly 1 base peak appears as a double peak in the normal sequencing data.

Cause

  • It can be caused by SNP or rarely point mutation.

Action

  • Compare the reaction results after several runnings if base calling is suspected.

Figure 6. Mixed Base

N-1 Primer

Pattern

  • Small peaks appears on the whole as like background.
  • Lower peaks from the base which is the same as the major peaks are shown right before major peaks.

Cause

  • Primer purification was not done properly during synthesis processes.
  • The primer was degraded.
  • The primer binding site in the sample is not appropriate.

Action

  • Mostly, this phenomenon is caused by primer purification or degradation. The clear results can be obtained by sequencing with the primer resynthesized.
  • Degradation can be confirmed by Psomagen MALDI (Matrix-assisted laser desorption/ionization) and Psomagen offers the service.(When employing oligonucleotides prepared 6 months or around 1 year ago check whether the degradation occurs before use or use oligonucleotides newly synthesized.

Figure 7. N-1 Primer

Frameshift Mutation

Pattern

  • Minor peaks, the same as N-1 primer pattern appears from a certain point.
  • The difference from N-1 primer is whereas N-1 peak appears from right after primer binding in case of N-1 primer it appears from the middle point in case of Frameshift Mutation.

Cause

  • Several products are made in a sample because one or more than one base is inserted or deleted in a template.

Action

  • Sample DNA should be newly prepared

Figure 8. Frameshift mutation (PCR samples)

Repeat Seq. (Microsatellite)

Pattern

  • It is the phenomenon that the peaks in back portion are overlapped due to the repetitive sequence (the repetition of 2 or more bases is shown).

Cause

  • It is thought that polymerase processing is interfered by repetitive sequence or the secondary structure is formed.

Action

  • Use the Difficult sequencing service of Psomagen. Difficult sequencing service of Psomagen is specialized for the case of signal decrease or sudden signal loss caused by unusual secondary structure or high GC sequence. Refer to http://www.macrogen.com/eng/sequencing/dna.jsp

Figure 9. Repeat-[GA]

Abrupt Signal Loss

Pattern

  • Peaks are suddenly stopped or rapidly lower. Whereafter data are not gained.

Cause

  • There is secondary structure existed in the sample.

Action

  • Perform sequencing toward the opposite direction of the corresponding result.
  • Use the Difficult sequencing service of Psomagen. Difficult sequencing service of Psomagen is specialized for signal decrease or sudden signal loss caused by unusual secondary structure or high GC sequence.

Figure 10. Abrupt Signal Loss

Dye Blob

Pattern

  • One or more peaks appear as wider and over-intensified peaks, commonly between 50 and 140.

Cause

  • This phenomenon can be shown when the sample volume is not used properly, based on the sample concentration.
  • Very small quantity of BigDye® left in the clean up process appears as large dye blob peaks.

Action

  • Reduce the error as measuring the sample concentration by a gel electrophoresis and spectrophotometer.

Figure 11. Dye Blob

Universal Primer List

Name Sequence(5′-3′) Name Sequence(5′-3′)
1492R TACGGYTACCTTGTTACGACTT M13R-pUC CAGGAAACAGCTATGAC
27F AGAGTTTGATCMTGGCTCAG MT_Forward CATCTCAGTGCAACTAAA
35S-A AAGGGTCTTGCGAAGGATAG pBacPAC-RP GTCTGTAAATCAACAACGC
35S-B AGTGGAAAAGGAAGGTGGCT pBAD-F ATGCCATAGCATTTTTATCCA
518F CCAGCAGCCGCGGTAATACG pBAD-FP ATGCCATAGCATTTTTATCC
800R TACCAGGGTATCTAATCC pBAD-R GATTTAATCTGTATCAGG
AD_Reverse AGATGGTGCACGATGCACAG pDONOR-FP TAACGCTAGCATGGATCTC
a-Factor TACTATTGCCAGCATTGCTGC pEGFP_N CCGTCCAGCTCGACCAG
AOX1_Forward GACTGGTTCCAATTGACAAGC pEGFP-FP TTTAGTGAACCGTCAGATC
AOX1_Reverse GCAAATGGCATTCTGACATCC pEGFP-RP AACAGCTCCTCGCCCTTG
BGH-R TAGAAGGCACAGTCGAGG pESP-RP TCCAAAAGAAGTCGAGTGG
Bluescript_KS TCGAGGTCGACGGTATC pET-24a GGGTTATGCTAGTTATTGCTCAG
Bluescript_SK CGCTCTAGAACTAGTGGATC pET-RP CTAGTTATTGCTCAGCGG
CMV-F CGCAAATGGGCGGTAGGCGTG pFastBac_Forward GGATTATTCATACCGTCCCA
CYC1_Reverse GCGTGAATGTAAGCGTGAC pFastBac_Reverse CAAATGTGGTATGGCTGATT
DsRed1-C AGCTGGACATCACCTCCCACAACG pGEX3 GGAGCTGCATGTGTCAGAGG
DsRed1-N GTACTGGAACTGGGGGGACAG pGEX5 GGCAAGCCACGTTTGGTG
EBV-RP GTGGTTTGTCCAAACTCATC pJET1_2F CGACTCACTATAGGGAGAGCGGC
EGFP-C CATGGTCCTGCTGGAGTTCGTG pJET1_2R AAGAACATCGATTTTCCATGGCAG
EGFP-CF AGCACCCAGTCCGCCCTGAGC pMalE TCAGACTGTCGATGAAGC
EGFP-CR CGTCCATGCCGAGAGTG pQE-F CCCGAAAAGTGCCACCTG
EGFP-N CGTCGCCGTCCAGCTCGACCAG pQE-R GTTCTGAGGTCATTACTGG
EGFP-NR CGTCGCCGTCCAGCTC pREP-fwd_primer GCTCGATACAATAAACGCC
GAL1_Forward AATATACCTCTATACTTTAACGTC pRH_Forward CTGTCTCTATACTCCCCTATAG
Gal4AD TACCACTACAATGGATG pRH_Reverse CAAAATTCAATAGTTACTATCGC
GLprimer1 TGTATCTTATGGTACTGTAACTG pTrcHis_Forward GAGGTATATATTAATGTATCG
GLprimer2 CTTTATGTTTTTGGCGTCTTCCA QE_Promoter CCGAAAAGTGCCACCTG
HCO2198 TAAACTTCAGGGTGACCAAAAAATCA RVprimer3 CTAGCAAAATAGGCTGTCCC
ITS1 TCCGTAGGTGAACCTGCGG RVprimer4 GACGATAGTCATGCCCCGCG
ITS2 GCTGCGTTCTTCATCGATGC SP6 ATTTAGGTGACACTATAG
ITS3 GCATCGATGAAGAACGCAGC STag_18mer_Primer GAACGCCAGCACATGGAC
ITS4 TCCTCCGCTTATTGATATGC SV40-pArev CCTCTACAAATGTGGTATGG
ITS5 GGAAGTAAAAGTCGTAACAAGG SV40-Promoter GCCCCTAACTCCGCCCATCC
KAN2-FP ACCTACAACAAAGCTCTCATCAACC T3 ATTAACCCTCACTAAAG
KAN2-RP GCAATGTAACATCAGAGATTTTGAG T7 AATACGACTCACTATAG
LCO1490 GGTCAACAAATCATAAAGATATTGG T7_EEV ATGTCGTAATAACCCCGCCCCG
M13F GTAAAACGACGGCCAGT T7promoter TAATACGACTCACTATAGGG
M13-FP TGTAAAACGACGGCCAGT T7terminator GCTAGTTATTGCTCAGCGG
M13F-pUC GTTTTCCCAGTCACGAC U-19mer_Primer GTTTTCCCAGTCACGACGT
M13R GCGGATAACAATTTCACACAGG

Inquire About Our CES Ordering Process